The whole process is seamlessly carried out in vitro. fragments of antigen binding (Fab) derived from single B cells [9,10,11]. Using this method, proteins can be rapidly synthesized just by mixing the cell-extract with PCR-amplified DNA templates, amino acids, nucleotides, T7 RNA polymerase and an energy source. However, practically available mAb screening was challenging due to Sirt6 the following technical problems. Firstly, active Fabs were sometimes not formed in the CFPS because of incorrect folding and assembling of heavy chain (Hc) and light chains (Lc). In particular, active Fabs were not produced at all in the case of rabbit mAb clones, probably because of the presence of too many Cys residues involved in disulfide bond formation [11,12]. Therefore, reconstruction of single chain Fv (scFv) genes was required for enzyme-linked immunosorbent assay (ELISA) evaluation. Secondly, the protein production levels significantly depend on the clones or genes and it was difficult to obtain enough mAb proteins in CFPS for ELISA Ouabain evaluation. In some cases, the amount of Hc and Lc gene templates included in the CFPS should be optimized [13,14]. To overcome such limitations, we have recently developed a modified Fab format named Zipbody that contains adhesive short peptides leucine zippers (LZ) at the C-terminus of the Hc and Lc, respectively. We found that the fusion of the LZ to the Fab could enhance correct pairing of the Hc and Lc, leading to the formation of active Fab in both CFPS and living cell expression systems [15]. Furthermore, we found that the Ouabain protein production levels can be markedly improved by just inserting 12 nucleotides next to the start Ouabain codon [16]. This sequence encodes a short peptide Ser-Lys-Ile-Lys (SKIK). Together with Zipbody and the SKIK peptide tag technologies, for improvement of Fab formation and protein production in CFPS, we have developed an improved SICREX system renewed as Ecobody technology [17]. Here, we demonstrate a 2-day protocol to complete screening of antigen-specific mAbs from single B cells of rabbits and Epstein-Barr Virus (EBV) infected human B cells. We further describe active Zipbody production in cytoplasmic expression system followed by refolding of inclusion bodies. Ecobody technology will be beneficial to the field of mAb research and development as a high-throughput and low-cost mAb screening method. 2. Materials and Methods 2.1. Overview of Ecobody Technology The scheme of Ecobody technology is illustrated in Figure 1. The details are designed as below; (i) Collect blood samples from immunized animals or human donors. (ii) Collect lymphocytes by density gradient centrifugation. (iii) Select target B cells by such as fluorescent reagents and magnetic beads. (iv) Separate single cells per wells by fluorescence-activated cell sorting, limiting Ouabain dilution method, or some other devices like micromanipulator. (v) RT-PCR from single Ouabain B cells to prepare Zipbody genes fused with N-terminal SKIK peptide tag. This step includes cell direct reverse transcription with mAb genes specific primers (15 min), first PCR to amplify Hc and Lc (1 h), second PCR to connect the required DNA tails for the following DNA assembly (1 h), Gibson assemble with the vector which contains sequences of T7 promoter, N-terminal SKIK peptide tag, Zipbody construct, His tag or HA tag, and T7 terminator (15 min), and final PCR to prepare Hc and Lc DNA fragments for expression. (vi) based cell-free protein synthesis (1.5 h). (vii) mAbs evaluation by ELISA (3 h). Open in a separate window Figure 1 Scheme of the Ecobody technology. The whole process is seamlessly carried out in vitro. The modified Fab (fragment of antigen binding) format Zipbody and N-terminal SKIK peptide tag are the key techniques to obtain enough and active monoclonal antibodies (mAb) proteins in cell-free protein synthesis. 2.2. Preparation of Antigens and Immunization of Rabbits Three types of antigens, bacteria NBRC 12711, O26 GTC14538 (verotoxin-1 producing strain), and non-toxic verotoxin 2 (VT2) were used as antigens for immunization of rabbits. Bacteria were obtained from the Biological Resource Center at the National Institute of Technology and Evaluation (NITE, Kisarazu, Japan) and the National BioResource Project GTC Collection (Gifu, Japan), cultured in Luria-Bertani (LB) medium at 37 C overnight, and inactivated by incubating at 80 C for 30 min in phosphate-buffered saline (PBS) containing 0.25% formalin. They were stored at ?20 C. Nontoxic VT2 (E167Q mutant) expression vector was prepared by PCR from VT2 producing O157 GTC 14535 strain with the primers AAGAAGGAGATATACATATGAAGTGTATATTATTTAAATGGGTACTG (forward) and TGGTGGTGGTGGTGCTCGAGGTCATTATTAAACTGCACTTCAGCAAAT (reverse) using KOD FX polymerase (Toyobo, Osaka,.
Home » Antivirals » The whole process is seamlessly carried out in vitro
Categories
- Antivirals
- AP-1
- Apelin Receptor
- APJ Receptor
- Apoptosis
- Apoptosis Inducers
- Apoptosis, Other
- APP Secretase
- Aromatic L-Amino Acid Decarboxylase
- Aryl Hydrocarbon Receptors
- ASIC3
- AT Receptors, Non-Selective
- AT1 Receptors
- AT2 Receptors
- Ataxia Telangiectasia and Rad3 Related Kinase
- Ataxia Telangiectasia Mutated Kinase
- ATM and ATR Kinases
- ATPase
- ATPases/GTPases
- ATR Kinase
- Atrial Natriuretic Peptide Receptors
- Aurora Kinase
- Autophagy
- Autotaxin
- AXOR12 Receptor
- c-Abl
- c-Fos
- c-IAP
- c-Raf
- C3
- Ca2+ Binding Protein Modulators
- Ca2+ Channels
- Ca2+ Ionophore
- Ca2+ Signaling
- Ca2+ Signaling Agents, General
- Ca2+-ATPase
- Ca2+Sensitive Protease Modulators
- Caged Compounds
- Calcineurin
- Calcitonin and Related Receptors
- Calcium (CaV) Channels
- Calcium Binding Protein Modulators
- Calcium Channels
- Calcium Channels, Other
- Calcium Ionophore
- Calcium-Activated Potassium (KCa) Channels
- Calcium-ATPase
- Calcium-Sensing Receptor
- Calcium-Sensitive Protease Modulators
- CaV Channels
Recent Posts
- Thus, STAT3 activation escalates the accurate variety of surviving tumor cells that invade faraway potent organs to create supplementary tumor
- and M
- at night
- Overall, 4/16 (25%) experienced complete fistula closure and 5/16 (31%) had partial fistula closure
- mouse skeletal muscle mass morphologyC3KOmice display the same muscular dystrophy phenotype while mice
← This finding is consistent with the observation that denguelike illness is rarely seen in infants Carcinogenesis →